View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0601_low_52 (Length: 254)

Name: NF0601_low_52
Description: NF0601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0601_low_52
NF0601_low_52
[»] chr7 (1 HSPs)
chr7 (1-146)||(47691550-47691693)


Alignment Details
Target: chr7 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 47691693 - 47691550
Alignment:
Q  1 atgatgtgatgtaaatttattaagcatgtggtacgaaacatattaaaaaatgcacaaagaaaatatgtatttcctcatatttgtgtttgaactcttttag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||| ||||||||||||||||    
T  47691693 atgatgtgatgtaaatttattaagcatgtggtacgaaacatattaaaaagtgca-aaagaaaatatgtattttctcatatttgcgtttgaactcttttag 47691595  T
Q  101 aaaatatttcatgatttagtctcattaaagctcatgatcttccttc 146  Q
     |||||||||||| ||||||||||||||||||||||||||||||||    
T  47691594 -aaatatttcatgttttagtctcattaaagctcatgatcttccttc 47691550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University