View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0594_low_36 (Length: 312)

Name: NF0594_low_36
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0594_low_36
NF0594_low_36
[»] chr1 (1 HSPs)
chr1 (95-229)||(3744555-3744689)


Alignment Details
Target: chr1 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 95 - 229
Target Start/End: Complemental strand, 3744689 - 3744555
Alignment:
Q  95 agtgtatgtgtgatggtctttgggggcagaagagtaccaggttgttttttaaggtcgtgcttgtgtgatggtatttggtttgatgtaataaaaattagta 194  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3744689 agtgtatgtgtgatggtctttgggggcagaagagtactaggttgttttttaaggtcgtgcttgtgtgatggtatttggtttgatgtaataaaaattagta 3744590  T
Q  195 attttgatttgcaatgcagttattctgtttctgtg 229  Q
    |||||||||||||||||||||||||||||||||||    
T  3744589 attttgatttgcaatgcagttattctgtttctgtg 3744555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University