View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0593_low_71 (Length: 269)

Name: NF0593_low_71
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0593_low_71
NF0593_low_71
[»] chr5 (2 HSPs)
chr5 (89-244)||(7691281-7691436)
chr5 (40-90)||(7691461-7691511)


Alignment Details
Target: chr5 (Bit Score: 144; Significance: 9e-76; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 89 - 244
Target Start/End: Complemental strand, 7691436 - 7691281
Alignment:
Q  89 ttacagccagagaattgcagttgcagaccgcaatttagaactattagcattgcagttcttccgtcttaattttcttgttaagaatattataacaagttat 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||  ||||||||||||||||||||||||||||||||||||||    
T  7691436 ttacagccagagaattgcagttgcagaccgcaatttagaactattagcattgcaattcttttgtcttaattttcttgttaagaatattataacaagttat 7691337  T
Q  189 gaagatgtttatcatttttattgttctatcacagatagatcacaattgcctatgat 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7691336 gaagatgtttatcatttttattgttctatcacagatagatcacaattgcctatgat 7691281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 40 - 90
Target Start/End: Complemental strand, 7691511 - 7691461
Alignment:
Q  40 ttaccatacaatgcggataaatatgcccgcagttgtattttcaatgtcgtt 90  Q
    |||| |||||||||||||||||||| ||||| |||||||||||||||||||    
T  7691511 ttacgatacaatgcggataaatatgaccgcaattgtattttcaatgtcgtt 7691461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University