View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0590_low_26 (Length: 207)

Name: NF0590_low_26
Description: NF0590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0590_low_26
NF0590_low_26
[»] chr4 (1 HSPs)
chr4 (1-118)||(31441944-31442061)


Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 31442061 - 31441944
Alignment:
Q  1 agtgccaccgtttgtccagcctcaactttgagattcaaaccctggaataccatttgctcaggtctagagggataagcaaagaatacatttttaagctcca 100  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31442061 agtgccaccgttcgtccagcctcaactttgagattcaaaccctggaataccatttgctcaggtctagagggataagcaaagaatacatttttaagctcca 31441962  T
Q  101 ccctgccccttattttcc 118  Q
    ||||||||||||||||||    
T  31441961 ccctgccccttattttcc 31441944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University