View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0586_low_83 (Length: 214)

Name: NF0586_low_83
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0586_low_83
NF0586_low_83
[»] chr2 (1 HSPs)
chr2 (1-131)||(387013-387143)


Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 387013 - 387143
Alignment:
Q  1 atggaaactttctaatgatggagtcaattcaatttagcttctgcttatgaggcaattacttaaaagatatgaggtccatctctttaagaaacttgtcctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  387013 atggaaactttctaatgatggagtcaattcaatttagcttctgcttatgaggcaattacttaaaagatatgaggtccatctctttaagaaacttgtcctt 387112  T
Q  101 gctctacaaatgctaatttggtttttctctg 131  Q
    |||||||||||||||||||||||||||||||    
T  387113 gctctacaaatgctaatttggtttttctctg 387143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University