View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0586_high_55 (Length: 248)

Name: NF0586_high_55
Description: NF0586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0586_high_55
NF0586_high_55
[»] chr7 (5 HSPs)
chr7 (100-211)||(25872544-25872650)
chr7 (142-211)||(25864041-25864109)
chr7 (1-35)||(25872715-25872749)
chr7 (174-202)||(25855467-25855495)
chr7 (1-33)||(25864234-25864266)
[»] chr6 (1 HSPs)
chr6 (151-207)||(17251619-17251674)


Alignment Details
Target: chr7 (Bit Score: 67; Significance: 7e-30; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 100 - 211
Target Start/End: Complemental strand, 25872650 - 25872544
Alignment:
Q  100 tagcgcttttgtcttgactactttgattgattgtatatgtcttttttcacggttttaccttaagttaactttgtttatgttcaaattataaaatttaatt 199  Q
    |||||||||| ||||||||||||||||||    |||||||| ||||||||||||||| ||| ||||||||||| |||||||||||| |||||||||||||    
T  25872650 tagcgcttttatcttgactactttgattg----tatatgtcctttttcacggttttatctttagttaactttg-ttatgttcaaatcataaaatttaatt 25872556  T
Q  200 aatatttagagt 211  Q
    ||||||||||||    
T  25872555 aatatttagagt 25872544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 142 - 211
Target Start/End: Complemental strand, 25864109 - 25864041
Alignment:
Q  142 tttttcacggttttaccttaagttaactttgtttatgttcaaattataaaatttaattaatatttagagt 211  Q
    |||||| |||||||||||| ||| ||||||||| ||||||||||| ||||||||| ||||||||||||||    
T  25864109 tttttctcggttttacctttagtcaactttgtt-atgttcaaattttaaaatttagttaatatttagagt 25864041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 25872749 - 25872715
Alignment:
Q  1 tttatgtcaacaaataatgcaaattagtaaaatga 35  Q
    |||||||||||||||||||||||||||||||||||    
T  25872749 tttatgtcaacaaataatgcaaattagtaaaatga 25872715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 202
Target Start/End: Complemental strand, 25855495 - 25855467
Alignment:
Q  174 ttatgttcaaattataaaatttaattaat 202  Q
    |||||||||||||||||||||||||||||    
T  25855495 ttatgttcaaattataaaatttaattaat 25855467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 25864266 - 25864234
Alignment:
Q  1 tttatgtcaacaaataatgcaaattagtaaaat 33  Q
    ||||||||||||||||||||||| |||||||||    
T  25864266 tttatgtcaacaaataatgcaaaatagtaaaat 25864234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 207
Target Start/End: Original strand, 17251619 - 17251674
Alignment:
Q  151 gttttaccttaagttaactttgtttatgttcaaattataaaatttaattaatattta 207  Q
    |||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||||    
T  17251619 gttttacctttagttaactttgtt-atgttcaaattataaaatttatttaatattta 17251674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University