View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0584_low_24 (Length: 280)

Name: NF0584_low_24
Description: NF0584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0584_low_24
NF0584_low_24
[»] chr8 (1 HSPs)
chr8 (35-185)||(11438695-11438845)


Alignment Details
Target: chr8 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 35 - 185
Target Start/End: Complemental strand, 11438845 - 11438695
Alignment:
Q  35 aggagcagagaaatgttgtaacttcttcttcttgtttcagcatgttgttgatctcttgaggatgttgttcgatctggttcctggttttgggtcggtgggt 134  Q
    |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |    
T  11438845 aggagcagagaagtgttgtaacttcttcttcttgtttcaacatgttgttgatctcttgaggatgttgttcgatctagttcctggttttgggtcggtggat 11438746  T
Q  135 cgtgtggatcccttggctgattgggttaaggattcgtagcatgtctgccga 185  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  11438745 cgtgtggatcccttggctggttgggttaaggattcgtagcatgtctgccga 11438695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University