View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0583_high_56 (Length: 340)

Name: NF0583_high_56
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0583_high_56
NF0583_high_56
[»] chr4 (2 HSPs)
chr4 (52-224)||(161574-161743)
chr4 (220-322)||(161447-161549)


Alignment Details
Target: chr4 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 52 - 224
Target Start/End: Complemental strand, 161743 - 161574
Alignment:
Q  52 tttgttctgccagattcatgaatgaggaggcttctctgttgataattgttgcattaatggttatctctcaacatatgtaatgatttattactccttcttt 151  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  161743 tttgttctgccagattcatgaatgaggaggcttctctgttgataattgttgcattaatggttatctctcaacatatgtaatgatttattactccttcttt 161644  T
Q  152 cttcttctgaagtacatgagaaactagcattgatttactctactgatggtatgggttttatagacaaactatc 224  Q
    |   |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  161643 c---ttctgaagtacatgagaaactagcattgatttactctattgatggtatgggttttatagacaaactatc 161574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 220 - 322
Target Start/End: Complemental strand, 161549 - 161447
Alignment:
Q  220 ctatctaatgtgttgtgtggaggttggaactttgcttcatgccattcgagattgtattcatgctaatttgttgtttttatattcatgttgtctttttggg 319  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
T  161549 ctatctaatgtgttgtgtggaggttagaactttgcttcatgccattcgagactgtattcatgctaatttgttgtttttatattgatgttgtctttttggg 161450  T
Q  320 ttt 322  Q
    |||    
T  161449 ttt 161447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University