View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0573_low_2 (Length: 445)

Name: NF0573_low_2
Description: NF0573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0573_low_2
NF0573_low_2
[»] chr7 (2 HSPs)
chr7 (235-306)||(42031532-42031603)
chr7 (373-431)||(42031670-42031728)
[»] chr2 (1 HSPs)
chr2 (52-153)||(27910902-27911003)


Alignment Details
Target: chr7 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 235 - 306
Target Start/End: Original strand, 42031532 - 42031603
Alignment:
Q  235 cttgtgttacagaacatttctctagaatggaaatatgagaatggatattttcatttttatattagtacatca 306  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  42031532 cttgtgttacagaacatttctctagaatggaaatatgagaatggatgttttcatttttatattagtacatca 42031603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 373 - 431
Target Start/End: Original strand, 42031670 - 42031728
Alignment:
Q  373 cggatttacttcgacataaggtggtttctttgaaggtgtttttacttgcttgacgtctt 431  Q
    ||||||||||| ||||||||  ||||||||||||||||| |||||||||||||||||||    
T  42031670 cggatttactttgacataagacggtttctttgaaggtgtctttacttgcttgacgtctt 42031728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 52 - 153
Target Start/End: Original strand, 27910902 - 27911003
Alignment:
Q  52 atgatgtttggatctcttaatgggaaatcgattctgaagtctagaattgattttagcataagcaactccttgtagcttttgcatctaggtgaattgattc 151  Q
    ||||||||||| ||||| || || |||| |||| ||||| |||||||||||||||  | |||| |||||||| ||||| ||| |||  ||||||||||||    
T  27910902 atgatgtttgggtctctgaagggaaaattgattatgaagcctagaattgattttactagaagctactccttggagcttctgcgtcttcgtgaattgattc 27911001  T
Q  152 ta 153  Q
    ||    
T  27911002 ta 27911003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University