View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0570_low_22 (Length: 273)

Name: NF0570_low_22
Description: NF0570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0570_low_22
NF0570_low_22
[»] chr3 (1 HSPs)
chr3 (51-130)||(28387887-28387966)


Alignment Details
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 51 - 130
Target Start/End: Original strand, 28387887 - 28387966
Alignment:
Q  51 cagtaaggcaaattgacagtaagggtttgagtttatttaattgagagaagtgggttgatagatggtggtgatattgttgg 130  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  28387887 cagtaaggcaaattgacagtaagggtttgagtttatttaattgagagaagtgggttgatagatggtggtgatgttgttgg 28387966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University