View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0551_low_21 (Length: 233)

Name: NF0551_low_21
Description: NF0551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0551_low_21
NF0551_low_21
[»] chr1 (3 HSPs)
chr1 (28-90)||(7888836-7888898)
chr1 (28-90)||(7891101-7891163)
chr1 (28-78)||(38138021-38138071)
[»] chr8 (1 HSPs)
chr8 (28-82)||(1846558-1846612)


Alignment Details
Target: chr1 (Bit Score: 55; Significance: 9e-23; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 28 - 90
Target Start/End: Complemental strand, 7888898 - 7888836
Alignment:
Q  28 caatttcttcatacctgtcctaggggtatatgggtgtagtggcatccatcttgttgcaacagc 90  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||    
T  7888898 caatttcttcatacctgtcctaggagtatatgggtgtagtggcatccatcttgttgcagcagc 7888836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 90
Target Start/End: Complemental strand, 7891163 - 7891101
Alignment:
Q  28 caatttcttcatacctgtcctaggggtatatgggtgtagtggcatccatcttgttgcaacagc 90  Q
    |||||| ||||||||| |||| || |||| ||||||||||||||||||||||||| |||||||    
T  7891163 caatttgttcatacctatccttggagtatttgggtgtagtggcatccatcttgttacaacagc 7891101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 78
Target Start/End: Complemental strand, 38138071 - 38138021
Alignment:
Q  28 caatttcttcatacctgtcctaggggtatatgggtgtagtggcatccatct 78  Q
    |||||||||||||||| |||| || |||| |||||||||||||||||||||    
T  38138071 caatttcttcatacctatccttggagtatttgggtgtagtggcatccatct 38138021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 82
Target Start/End: Original strand, 1846558 - 1846612
Alignment:
Q  28 caatttcttcatacctgtcctaggggtatatgggtgtagtggcatccatcttgtt 82  Q
    |||||| ||||||||| |||| || |||| |||||||||||||||||||||||||    
T  1846558 caatttgttcatacctatccttggagtatttgggtgtagtggcatccatcttgtt 1846612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University