View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0548_low_45 (Length: 251)

Name: NF0548_low_45
Description: NF0548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0548_low_45
NF0548_low_45
[»] chr5 (1 HSPs)
chr5 (12-251)||(6290167-6290402)


Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 6290402 - 6290167
Alignment:
Q  12 aattctaaaataacaactttgcattggcaaattgaagcatgaaattaacatgctttattataagcttattatcgatcgattgacacatattgatacatca 111  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||    
T  6290402 aattataaaataacaactttgcattggcaaattgaagcatgaaattaacatgctttattataagcttattatcgat----tgacacatattgatacatca 6290307  T
Q  112 gtcttctttgaaatgtctttcaatggatccgagaagagttgaattgatataatcttggggaccatgagcaggtaatcctggaattagtaaaccaaccatc 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6290306 gtcttctttgaaatgtctttcaatggatccgagaagagttgaattgatataatcttggggaccatgagcaggtaatcctggaattagtaaaccaaccatc 6290207  T
Q  212 ctaaagaagaagagaaaccatccttctctatagtgaggtc 251  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  6290206 ctaaagaagaagagaaaccatccttctctatagtgaggtc 6290167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University