View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0547_low_158 (Length: 203)

Name: NF0547_low_158
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0547_low_158
NF0547_low_158
[»] chr3 (1 HSPs)
chr3 (1-152)||(31704361-31704512)


Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 31704361 - 31704512
Alignment:
Q  1 cattaagattaaaattcaccaatttgatagcagactacatgaatctttaaccccttaatataccataatcatgaaagagatttaatatgtgacacattga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31704361 cattaagattaaaattcaccaatttgatagcagactacatgaatctttaaccccttaatataccataatcatgaaagagatttaatatgtgacacattga 31704460  T
Q  101 aaagttacagcactgtaaattcatttggaagatcatgtgtgcctatgatact 152  Q
    |||||||||| ||||||||||||||||||||||||||||||| |||| ||||    
T  31704461 aaagttacagtactgtaaattcatttggaagatcatgtgtgcttatgttact 31704512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University