View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0543_high_16 (Length: 340)

Name: NF0543_high_16
Description: NF0543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0543_high_16
NF0543_high_16
[»] chr4 (1 HSPs)
chr4 (282-335)||(38249490-38249543)


Alignment Details
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 282 - 335
Target Start/End: Original strand, 38249490 - 38249543
Alignment:
Q  282 caatattaaaaagggcaagataaactacacaaatatgcatgaaaaaacatagtt 335  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  38249490 caatattaaaaaaggcaagataaactacacaaatatgcatgaaaaaacatagtt 38249543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University