View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0532_low_25 (Length: 345)

Name: NF0532_low_25
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0532_low_25
NF0532_low_25
[»] chr2 (2 HSPs)
chr2 (183-316)||(43837043-43837176)
chr2 (183-316)||(39871994-39872130)


Alignment Details
Target: chr2 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 183 - 316
Target Start/End: Original strand, 43837043 - 43837176
Alignment:
Q  183 tttgggagaaaagtagttaacctttagaaaggaaacattatggaaaaatatatatcatgatgccttgcttgagcattttcaaacattcttccgtgtcccc 282  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  43837043 tttgggagaaaagtagttaacctttagaaaggaaacattatggaaaaatatatatcaggatgccttgcttgagcattttcaaacattcttccgtgtcccc 43837142  T
Q  283 cacttttttgggtgatgcagatgtaatttagatt 316  Q
    | |||||||||||||| |||||||||||||||||    
T  43837143 ctcttttttgggtgattcagatgtaatttagatt 43837176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 183 - 316
Target Start/End: Original strand, 39871994 - 39872130
Alignment:
Q  183 tttgggagaaaagtagtt---aacctttagaaaggaaacattatggaaaaatatatatcatgatgccttgcttgagcattttcaaacattcttccgtgtc 279  Q
    ||||||||||||||||||   |||||| |||||||||||||||||||||||||||| | | |||||||||||||||||||||||||| |||||| |  ||    
T  39871994 tttgggagaaaagtagttgttaaccttcagaaaggaaacattatggaaaaatatatgttaggatgccttgcttgagcattttcaaactttcttcagcttc 39872093  T
Q  280 ccccacttttttgggtgatgcagatgtaatttagatt 316  Q
    |||| |||||||||||||| |||||||||||||||||    
T  39872094 cccctcttttttgggtgatccagatgtaatttagatt 39872130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University