View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0529_low_81 (Length: 247)

Name: NF0529_low_81
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0529_low_81
NF0529_low_81
[»] chr2 (2 HSPs)
chr2 (1-117)||(40010857-40010973)
chr2 (150-239)||(40010985-40011074)


Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 40010857 - 40010973
Alignment:
Q  1 ttccacttggaaatgtttgattttaagaggataatcattttctctttcttttcgcatcaactatgttcaggaaatagaacgtcaagttcctttaatggat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||    
T  40010857 ttccacttggaaatgtttgattttaagaggataatcattttctctttcttttcgcctcgactatgttcaggaaatagaacgtcaagttcctttaatggat 40010956  T
Q  101 gaaatggacgcaaaggt 117  Q
    |||||||||||||||||    
T  40010957 gaaatggacgcaaaggt 40010973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 150 - 239
Target Start/End: Original strand, 40010985 - 40011074
Alignment:
Q  150 tcaatcttgctttttctatattggaataaataactttgcaaagtaatattgcaagtatgtaagtaaatacattacaaggtgctctgtgct 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40010985 tcaatcttgctttttctatattggaataaataactttgcaaagtaatattgcaagtatgtaagtaaatacattacaaggtgctctgtgct 40011074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University