View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0529_high_57 (Length: 212)

Name: NF0529_high_57
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0529_high_57
NF0529_high_57
[»] chr1 (1 HSPs)
chr1 (6-78)||(40964590-40964662)


Alignment Details
Target: chr1 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 6 - 78
Target Start/End: Complemental strand, 40964662 - 40964590
Alignment:
Q  6 ttaactcctttttatctttattcataatattgttgagttgaatgtttatcattgtccctaatatacctatgat 78  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||    
T  40964662 ttaactcctttttatctttattcataattttgttgagttgaatgtttatcattgtccctaatatacctttgat 40964590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University