View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0526_low_88 (Length: 245)

Name: NF0526_low_88
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0526_low_88
NF0526_low_88
[»] chr8 (3 HSPs)
chr8 (23-56)||(14663321-14663354)
chr8 (183-214)||(14663137-14663168)
chr8 (74-110)||(14663253-14663289)
[»] chr5 (1 HSPs)
chr5 (23-56)||(5079959-5079992)


Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 14663354 - 14663321
Alignment:
Q  23 catcttcttcctcttttcccttaaccaaatcaaa 56  Q
    ||||||||||||||||||||||||||||||||||    
T  14663354 catcttcttcctcttttcccttaaccaaatcaaa 14663321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 214
Target Start/End: Complemental strand, 14663168 - 14663137
Alignment:
Q  183 atcgatctcaggtatctcaattcctatcctat 214  Q
    ||||||||||||||||||||||||||||||||    
T  14663168 atcgatctcaggtatctcaattcctatcctat 14663137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 110
Target Start/End: Complemental strand, 14663289 - 14663253
Alignment:
Q  74 gattacttgatccttccagcaagctatgaccatgttc 110  Q
    |||||||||||||||||| |||||||| |||||||||    
T  14663289 gattacttgatccttccatcaagctattaccatgttc 14663253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 56
Target Start/End: Original strand, 5079959 - 5079992
Alignment:
Q  23 catcttcttcctcttttcccttaaccaaatcaaa 56  Q
    ||||||||||||||||||||||||||||||||||    
T  5079959 catcttcttcctcttttcccttaaccaaatcaaa 5079992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University