View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0526_high_88 (Length: 214)

Name: NF0526_high_88
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0526_high_88
NF0526_high_88
[»] chr6 (1 HSPs)
chr6 (1-105)||(1026671-1026775)


Alignment Details
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 1026671 - 1026775
Alignment:
Q  1 tctgattataagattcatctctcttaatctcttggtgttgtaaattgtagtggcaattgcaatcacaaacttgatctgatatataagaaaaacccatttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1026671 tctgattataagattcatctctcttaatctcttggtgttgtaaattgtagtggcaattgcaatcacaaacttgatctgatatataagaaaaacccatttg 1026770  T
Q  101 aggaa 105  Q
    |||||    
T  1026771 aggaa 1026775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University