View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0519_high_20 (Length: 219)

Name: NF0519_high_20
Description: NF0519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0519_high_20
NF0519_high_20
[»] chr7 (1 HSPs)
chr7 (1-121)||(30346034-30346146)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 30346146 - 30346034
Alignment:
Q  1 aagtagaaaatttatctgcacatggtgcagtacaagtgctgatttcctctaatagtaatgcttactaactactaaagtcactgagcactagaagaatgta 100  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||        |||||||| |||||||||||||||||    
T  30346146 aagtagaaaatttatctgcgcatggtgcagtacaagtgctgatttcctctaatagtaatgcttact--------aagtcactaagcactagaagaatgta 30346055  T
Q  101 cagaggaataatagaagtgct 121  Q
    |||||||||||||||||||||    
T  30346054 cagaggaataatagaagtgct 30346034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University