View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0509_low_12 (Length: 215)

Name: NF0509_low_12
Description: NF0509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0509_low_12
NF0509_low_12
[»] chr8 (1 HSPs)
chr8 (1-125)||(43861978-43862102)


Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 43861978 - 43862102
Alignment:
Q  1 gaagatgatgttgattatgattagtgtattgttaatttgttaaggagaggaggcagttgcacctgttcttaatcaatcttgcaaggaacaagggaaaggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  43861978 gaagatgatgttgattatgattagtgtattgttaatttgttaaggagaggaggcagttgcacctgttcttaatcaatattgcaaggaacaagggaaaggg 43862077  T
Q  101 tatgatccctctgacgatgatgatg 125  Q
    ||||||||||||||||| |||||||    
T  43862078 tatgatccctctgacgacgatgatg 43862102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University