View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0501_low_6 (Length: 232)

Name: NF0501_low_6
Description: NF0501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0501_low_6
NF0501_low_6
[»] chr1 (1 HSPs)
chr1 (14-73)||(38603531-38603590)


Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 14 - 73
Target Start/End: Complemental strand, 38603590 - 38603531
Alignment:
Q  14 atttgccaaccttaagccaaccacgtgtgaccacaaaacgacaacctcacttttactctc 73  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38603590 atttgccaaccttaagccaaccacgtgtgaccacaaaacgacaacctcacttttactctc 38603531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University