View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0500_low_37 (Length: 208)

Name: NF0500_low_37
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0500_low_37
NF0500_low_37
[»] chr6 (1 HSPs)
chr6 (24-164)||(34122524-34122664)


Alignment Details
Target: chr6 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 24 - 164
Target Start/End: Complemental strand, 34122664 - 34122524
Alignment:
Q  24 atatttctcctgttataaaaataaaatgaatttttcaatcaaccaaaaatatgttaccctaagaatgacactatacattgatggacattgttgttattgt 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34122664 atatttctcctgttataaaaataaaatgaatttttcaatcaaccaaaaatatgttaccctaagaatgacactatacattgatggacattgttgttattgt 34122565  T
Q  124 tcatctattgatgattcttattacaacatctttcccatata 164  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  34122564 tcatctattgatgattcttattacaacatctttcccatata 34122524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University