View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0483_low_6 (Length: 248)

Name: NF0483_low_6
Description: NF0483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0483_low_6
NF0483_low_6
[»] chr4 (1 HSPs)
chr4 (12-161)||(56312444-56312593)
[»] chr8 (1 HSPs)
chr8 (157-238)||(3428365-3428446)


Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 12 - 161
Target Start/End: Original strand, 56312444 - 56312593
Alignment:
Q  12 gaagtatcgaaacggtgatcgtccaaatcgtgtaacaacttctggttattggaaggcaacaggagcagataggatgattcgaactgaaaacttccgttca 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  56312444 gaagtatcgaaacggtgatcgtccaaatcgtgtaacaacttctggttattggaaggcaacaggagcggataggatgattcgaactgaaaacttccgttca 56312543  T
Q  112 attggactcaagaaaaccctagttttctattctggaaaagctcctaaagg 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  56312544 attggactcaagaaaaccctagttttctattctggaaaagctcctaaagg 56312593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 3428446 - 3428365
Alignment:
Q  157 aaaggtttccttacatgatatacataactgttctagaaaaatagaaaatagagggaaagttaggagatcaaggagcaaaaac 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  3428446 aaaggtttccttacatgatatacataactgttctagaaaaatagaaaatatagggaaagttaggagatcaaggagcaaaaac 3428365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University