View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0469_high_12 (Length: 206)

Name: NF0469_high_12
Description: NF0469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0469_high_12
NF0469_high_12
[»] chr2 (3 HSPs)
chr2 (1-125)||(37155721-37155845)
chr2 (1-125)||(37161322-37161446)
chr2 (1-124)||(37150595-37150718)


Alignment Details
Target: chr2 (Bit Score: 125; Significance: 1e-64; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 37155721 - 37155845
Alignment:
Q  1 agtttcgacggctagatggttatcagggattgaatcgtcggcaagagaacgagaaacagtccggagtttaagatgatctgaggtcggaacaccttcagga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37155721 agtttcgacggctagatggttatcagggattgaatcgtcggcaagagaacgagaaacagtccggagtttaagatgatctgaggtcggaacaccttcagga 37155820  T
Q  101 caatattcagctaagtaccattctc 125  Q
    |||||||||||||||||||||||||    
T  37155821 caatattcagctaagtaccattctc 37155845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 37161322 - 37161446
Alignment:
Q  1 agtttcgacggctagatggttatcagggattgaatcgtcggcaagagaacgagaaacagtccggagtttaagatgatctgaggtcggaacaccttcagga 100  Q
    |||||| || |||||||| ||||||||||||||||| |||||||||||| |||| ||||| ||||||||||||||||||||||| |||||||||||||      
T  37161322 agtttcaactgctagatgattatcagggattgaatcatcggcaagagaaagagacacagtacggagtttaagatgatctgaggttggaacaccttcagtg 37161421  T
Q  101 caatattcagctaagtaccattctc 125  Q
     ||||| ||||||||||||||||||    
T  37161422 gaatatccagctaagtaccattctc 37161446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 37150595 - 37150718
Alignment:
Q  1 agtttcgacggctagatggttatcagggattgaatcgtcggcaagagaacgagaaacagtccggagtttaagatgatctgaggtcggaacaccttcagga 100  Q
    ||||||||||  |||||||| |||||||||||| || | |||||||||| |||||||||| ||||||||||||||||| || || |||||||| ||||||    
T  37150595 agtttcgacgattagatggtcatcagggattgattcatgggcaagagaaagagaaacagtgcggagtttaagatgatccgacgttggaacaccctcagga 37150694  T
Q  101 caatattcagctaagtaccattct 124  Q
     | ||| |||||| ||||||||||    
T  37150695 gagtatgcagctacgtaccattct 37150718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University