View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0457-Insertion-5 (Length: 142)

Name: NF0457-Insertion-5
Description: NF0457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0457-Insertion-5
NF0457-Insertion-5
[»] chr5 (3 HSPs)
chr5 (8-141)||(10664814-10664947)
chr5 (47-111)||(10661793-10661857)
chr5 (52-111)||(7191447-7191506)


Alignment Details
Target: chr5 (Bit Score: 126; Significance: 2e-65; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 126; E-Value: 2e-65
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 10664947 - 10664814
Alignment:
Q  8 caattggcatggaatcacatgcaaccccttactattatatcagttgcactcaatgattttaatggctcttttccacccagtatgttcaacaccctctcca 107  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  10664947 caattggcatggaatcacatgcaaccccttactattgtatcagttgcactcaattattttaatggctcttttccacccagtatgttcaacaccctctcca 10664848  T
Q  108 atctcaggtctaatccctatttcacttgcaaatg 141  Q
    ||||||||||||||||||||||||||||||||||    
T  10664847 atctcaggtctaatccctatttcacttgcaaatg 10664814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 47 - 111
Target Start/End: Complemental strand, 10661857 - 10661793
Alignment:
Q  47 tcagttgcactcaatgattttaatggctcttttccacccagtatgttcaacaccctctccaatct 111  Q
    ||||||| || ||||||||||||||| ||| ||||| ||| ||||||||||||||||||||||||    
T  10661857 tcagttggacccaatgattttaatggatctcttccatccaatatgttcaacaccctctccaatct 10661793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 52 - 111
Target Start/End: Original strand, 7191447 - 7191506
Alignment:
Q  52 tgcactcaatgattttaatggctcttttccacccagtatgttcaacaccctctccaatct 111  Q
    |||| ||||| |||||||||| ||| ||||||||| ||||||||||||||||||||||||    
T  7191447 tgcattcaataattttaatggatctcttccacccaatatgttcaacaccctctccaatct 7191506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University