View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0437_low_21 (Length: 301)

Name: NF0437_low_21
Description: NF0437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0437_low_21
NF0437_low_21
[»] chr1 (1 HSPs)
chr1 (98-238)||(23945065-23945205)


Alignment Details
Target: chr1 (Bit Score: 129; Significance: 9e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 98 - 238
Target Start/End: Complemental strand, 23945205 - 23945065
Alignment:
Q  98 ctttccactttaatccactcaccatgcaaagaatccggttcaccattaatacccaagatatcagttttgaacggaaactcctccatcattattcctgatt 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  23945205 ctttccactttaatccactcaccatgcaaagaatccggttcaccattaatacccaagatatcagttttgaacggaatctcctccatcattattcctgatt 23945106  T
Q  198 tttcgtttttaccgttacccacattaaagttgttaccgttc 238  Q
    ||||||||||||||||||||||||||| ||||||| |||||    
T  23945105 tttcgtttttaccgttacccacattaatgttgttatcgttc 23945065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University