View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0415_low_11 (Length: 309)

Name: NF0415_low_11
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0415_low_11
NF0415_low_11
[»] chr1 (2 HSPs)
chr1 (95-240)||(38160802-38160947)
chr1 (95-239)||(38116976-38117120)
[»] chr4 (1 HSPs)
chr4 (95-239)||(49004779-49004923)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 95 - 240
Target Start/End: Original strand, 38160802 - 38160947
Alignment:
Q  95 ctttgaactttgaaatatgcaggattcacaaggagcaggtcgaaaagtggcaggaagaaatcaaagaattgcgggcacttgatgcctcaaatgaggaagc 194  Q
    |||| ||||||  ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||||    
T  38160802 cttttaactttccaatatgcaggattcacaaggagcaggtcgaaaaatggcaggaagaaatcaaagaactgcgtgcacttgatgcctcaaatgaggaagc 38160901  T
Q  195 caaagctcttctgcaaaatgctcgatacgtacttcatctcactcga 240  Q
    ||| ||||||||||||||||||||||| |||||||| |||||||||    
T  38160902 caatgctcttctgcaaaatgctcgatatgtacttcagctcactcga 38160947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 95 - 239
Target Start/End: Original strand, 38116976 - 38117120
Alignment:
Q  95 ctttgaactttgaaatatgcaggattcacaaggagcaggtcgaaaagtggcaggaagaaatcaaagaattgcgggcacttgatgcctcaaatgaggaagc 194  Q
    |||| |||||| ||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||| | || ||||| ||||||||||||||||||||    
T  38116976 cttttaactttcaaataagcaggattcacaaggagcaggttgaaaaatggcaggaagaaatcaaagaactccgtgcactcgatgcctcaaatgaggaagc 38117075  T
Q  195 caaagctcttctgcaaaatgctcgatacgtacttcatctcactcg 239  Q
    ||| ||||||||||||||||||||||| |||||||| ||||||||    
T  38117076 caatgctcttctgcaaaatgctcgatatgtacttcagctcactcg 38117120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 95 - 239
Target Start/End: Original strand, 49004779 - 49004923
Alignment:
Q  95 ctttgaactttgaaatatgcaggattcacaaggagcaggtcgaaaagtggcaggaagaaatcaaagaattgcgggcacttgatgcctcaaatgaggaagc 194  Q
    |||| |||||| ||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||| | || ||||| ||||||||||||||||||||    
T  49004779 cttttaactttcaaataagcaggattcacaaggagcaggttgaaaaatggcaggaagaaatcaaagaactccgagcactcgatgcctcaaatgaggaagc 49004878  T
Q  195 caaagctcttctgcaaaatgctcgatacgtacttcatctcactcg 239  Q
    ||| ||||||||||||||||||||||| |||||||| ||||||||    
T  49004879 caatgctcttctgcaaaatgctcgatatgtacttcagctcactcg 49004923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University